perl - How can I put N's in my final string -


i'm beginner in perl im have problems writing script. want script put letter n 1 number of times basis in length previous check. ns have in final of string inside .txt. strings begin > , have 'face':

a1_23abr2014_53_cc07.p10r_e07_009.ab1

attgccttttgctagcttatagaataataattcatataaacaaaaaatat tttatattatttaaaaataaataaaccaaataaagtcattgttgatccaa ttgaacaaatcatattccatccatttaaagcgtctggataatcaggaata cgtctaggcattacattaaatccaagaaaatgcataggtaagaatgttaa

i wrote that, don't know how next.

if $qend > $sendi{     $leg1 = $qendi - $sendi;     open(my @final, '>>', 'contiggeral.fasta') or die;     while (n < $leg1) {     n++ in @nomecontig }

thanks , sorry bad english.

the condition if non-modifier if must enclosed in parentheses. variables must start sigil (n has none). there no in operator in perl.

my $string = 'abc'; $final_length = 20; $string .= 'n' x ($final_length - length $string); print $string, "\n";

Comments

Post a Comment

Popular posts from this blog

javascript - RequestAnimationFrame not working when exiting fullscreen switching space on Safari -

request animation frame stops working when exiting fullscreen clicking on original space's safari window. fine if fullscreen mode canceled escape key or calling cancelfullscreen(). steps reproduce: open https://dl.dropboxusercontent.com/u/769042/prezi/safari-fullscreen.html click "draw raf", kittie appears click "fullscreen", go fullscreen click "draw raf", kittie appears go space original safari was, showing "click exit fullscreen mode", click anywhere, out fullscreen click "draw raf", nothing happens what handling click calling: window.requestanimationframe(draw); which draws on canvas context: function draw() { ctx.drawimage(img, math.random()*500|0, math.random()*400|0, 100, 100); } i checked .hidden , .visibilitystate, updated correctly. tested on osx 10.9.3, safari 7.0.4 (9537.76.4). has workaround/solution other switching old settimeout? this sounds webkit bug 88940 : using reque...
Read more

postgresql - how to get points from linestring postgis -

i have linestring (0 0 , 2 4 , 5 5); i need output in form : x (1st cell) || y (2nd cell) 0 || 0 2 || 4 5 || 5 and same polygon. how ? you can use st_x , st_y in conjunction st_pointn x , y of individual points, , use generate_series create index each point of linestring, eg, with line (select st_geomfromtext('linestring(0 0, 2 4, 5 5)') geom) select st_x(st_pointn(geom,num)) x, st_y(st_pointn(geom,num)) y line, (select generate_series(1, (select st_numpoints(geom) line)) num) series;
Read more

Why am I getting Internal .NET Framework Data Provider error 1025 when passing Method to where? -

i have method takes generic tentity overriden. it's signature follows: public virtual expression<func<aclproject, bool>> projectfilter(params tentity[] objs) { return (p) => objs.select(o => o.id).contains(p.id); } i filter query based on this: from p in db.somedbset db.aclprojects.where(projectfilter(p)).any() select p this results in 1025 error. (note doesn't matter body of projectfilter is, error still occurs. any ideas why? thanks!
Read more