bioinformatics - Querying NCBI for a sequence from ncbi via Biopython -


how can query ncbi sequences given chromosome's genbank identifier, , start , stop positions using biopython?

cp001665    napp    tile    6373    6422    .   +   .   cluster=9;  cp001665    napp    tile    6398    6447    .   +   .   cluster=3;  cp001665    napp    tile    6423    6472    .   +   .   cluster=3;  cp001665    napp    tile    6448    6497    .   +   .   cluster=3; cp001665    napp    tile    7036    7085    .   +   .   cluster=10;  cp001665    napp    tile    7061    7110    .   +   .   cluster=3;  cp001665    napp    tile    7073    7122    .   +   .   cluster=3; 

from bio import entrez bio import seqio  entrez.email = "sample@example.org"  handle = entrez.efetch(db="nuccore",                        id="cp001665",                        rettype="gb",                        retmode="text")  whole_sequence = seqio.read(handle, "genbank")  print whole_sequence[6373:6422]

once know id , database fetch from, use entrez.efetch handle file. should specify returning type (rettype="gb") , mode (retmode="text"), handler filelike data.

then pass handler seqio, should return seqrecord object. 1 nice feature of seqrecords can cleanly sliced lists. if can retrieve starting , ending points somewhere, above print statement returns:

id: cp001665.1 name: cp001665 description: escherichia coli 'bl21-gold(de3)plyss ag', complete genome. number of features: 0 seq('gcgctaaccatgcgagcgtgcctgatgcgctacgcttatcaggcctacg', iupacambiguousdna())

Comments

Post a Comment

Popular posts from this blog

javascript - RequestAnimationFrame not working when exiting fullscreen switching space on Safari -

request animation frame stops working when exiting fullscreen clicking on original space's safari window. fine if fullscreen mode canceled escape key or calling cancelfullscreen(). steps reproduce: open https://dl.dropboxusercontent.com/u/769042/prezi/safari-fullscreen.html click "draw raf", kittie appears click "fullscreen", go fullscreen click "draw raf", kittie appears go space original safari was, showing "click exit fullscreen mode", click anywhere, out fullscreen click "draw raf", nothing happens what handling click calling: window.requestanimationframe(draw); which draws on canvas context: function draw() { ctx.drawimage(img, math.random()*500|0, math.random()*400|0, 100, 100); } i checked .hidden , .visibilitystate, updated correctly. tested on osx 10.9.3, safari 7.0.4 (9537.76.4). has workaround/solution other switching old settimeout? this sounds webkit bug 88940 : using reque
Read more

Python ctypes access violation with const pointer arguments -

i have api i'm trying wrap in python (2.7.6 on win7) code using ctypes. here's api: client_dllfunc bool clientapi search_exporttoclipcopy(clienthsearch handle, int channel, lpctstr filename, const time_t& from, const time_t& to, const bool* cameras, int length, bool usepassword, lpctstr password, bool includetextin = false, bool excludeplayer = false); the issue i'm having cameras argument; , i've had issue other const pointer arguments well. here's how i'm wrapping api: def search_exporttoclipcopy(self, hsearch, csearch, filename, tfrom, tto, cameras, length, usepassword, password, includetextin=true, excludeplayer=false): exporttoclipcopy = self.sdkdll.search_exporttoclipcopy exporttoclipcopy.argtypes = [c_int, c_int, c_wchar_p, c_long, c_long, pointer(c_bool), c_int, c_bool, c_wchar_p, c_bool, c_bool] exporttoclipcopy.restype = c_bool exporttoclipcopy(hsearch, csearch, filename, tfrom, tto, cameras, length, usepassword, pass
Read more